
| |  | |  | |
| Differential Expression of Human Metallothionein Isoform I mRNA in Human Proximal Tubule Cells Exposed to Metals Scott H. Garrett, Seema Somji, John H. Todd, Mary Ann Sens, and Donald A. Sens Robert C. Byrd Health Sciences Center, Department of Pathology, West Virginia University, Morgantown, WV 26506 USA Abstract In contrast to the single metallothionein (MT) -1 gene of the mouse, the human MT-1 gene family is composed of seven active genes and six pseudogenes. In this study, the expression of mRNA representing the seven active human MT-1 genes was determined in cultured human proximal tubule (HPT) cells under basal conditions and after exposure to the metals Cd2+, Zn2+, Cu2+, Hg2+, Ag2+, and Pb2+. Basal expression of MT-1X and MT-1E mRNA in HPT cells was similar to expression of the housekeeping gene glyceraldehyde 3-phosphate dehydrogenase. In contrast, mRNAs representing the basal expression of MT-1A and MT-1F were a minor transcript in HPT cells. Treatment of HPT cells with Cd2+, Zn2+, or Cu2+ increased the levels of MT-1E and MT-1A mRNA, but not the levels of MT-1X or MT-1F mRNA. The increase in MT-1E mRNA appeared to be influenced mainly by exposure to the various metals, whereas the increase in MT-1A mRNA was influenced more by exposure to a metal concentration eliciting a loss of cell viability. Treatment of HPT cells with the metals Hg2+, Ag2+, and Pb2+ was found to have no effect on the level of MT-1 mRNA at either sublethal or lethal concentrations. Using HPT cells as a model, these results suggest that new features of MT gene expression have been acquired in the human due to the duplication of the MT-1 gene. Key words: cadmium, copper, gene expression, heavy metals, lead, mercury, metallothionein, mRNA, proximal tubule, RT-PCR, reverse transcriptase-polymerase chain reaction, silver, zinc. Environ Health Perspect 106:825-832 (1998) . [Online 17 November 1998] http://ehpnet1.niehs.nih.gov/docs/1998/106p825-832garrett/ abstract.html Address correspondence to D.A. Sens, Department of Pathology, West Virginia University, P.O. Box 9203, Morgantown, WV 26506-9203. This publication was made possible by grant number ESO7687 from the National Institute of Environmental Health Sciences. Received 3 June 1998 ; accepted 4 August 1998. |
|
|
 |
The extrapolation of environmental studies from animal models to humans is potentially compromised when areas of examination involve human gene families with increased organizational complexity. A prime example is the human metallothionein (MT) gene family, in which gene organization is more complex in humans than in commonly used model systems. In both mice and humans, there are four classes of similar MT proteins, designated MT-1 through 4, defined on the basis of small differences in sequence and charge characteristics ( 1- 3). For both species, the MT-1 and MT-2 proteins exhibit a ubiquitous pattern of tissue expression, whereas expression of the MT-3 and MT-4 family members is highly restricted ( 3- 5). However, the gene organizations underlying the expression of the protein isoforms are quite different. In the mouse, the genes encoding the four MT isoforms are single-copy genes, and no MT pseudogenes are known to exist. The mouse MT-1 and MT-2 genes are separated by approximately 6 kb on chromosome 8 and appear to be coordinately regulated with functionally equivalent protein products ( 3, 6). The MT-3 and MT-4 genes are closely linked to but not coordinately regulated with the other MT genes on mouse chromosome 8 ( 4, 5). In contrast to the four single genes of the mouse, the human MT gene family is represented by 10 functional and 7 nonfunctional genes located at 16q13 ( 4, 5, 7, 8). The genes encoding the MT-2, 3, and 4 isoforms are similar in number to the rodent (there is an MT-2 processed pseudogene on chromosome 2), but the human MT-1 locus possesses numerous MT-1 isoforms that are not present in the mouse ( 7, 8). The human MT-1 gene locus is composed of seven functional genes and six pseudogenes. Complete genomic sequences are available for the seven active genes: MT-1A ( 9), MT-1B ( 10), MT-1E, MT-1F, MT-1G ( 11, 12), MT-1H, and MT-1X ( 8). The potential significance of this duplication event is underscored by the fact that the human MT-1 isoforms genes have been shown to exhibit unique expression profiles with examples of inducer-specific, tissue-specific, and developmental-specific regulation ( 9, 13- 17).
The MTs are widely recognized and accepted as a major weapon in the cell's armamentarium for protection against and recovery from environmental insult. They are a class of low molecular weight (Mr = 6,000-7,000), cysteine-rich, inducible, intracellular stress proteins that are best known for their high affinity for binding heavy metals. They are believed to serve an important role in the homeostasis of essential metals such as Zn2+ or Cu2+ during growth and development as well as in the detoxification of heavy metals such as Cd2+ and Hg2+; rendering the MTs important mediators/attenuators of heavy metal-induced toxicity, particularly hepato- and nephrotoxicity (1,3,18-20). To begin to define the regulation of expression of the MT gene family in human tissues and cells exposed to metals, we have undertaken an analysis of the metal-induced expression of the MT gene family in cultures of human proximal tubule (HPT) cells. This cell culture system was chosen because the kidney, and the proximal tubule in particular, represent an organ and cell type that are critically affected by chronic Cd2+ exposure in both animals and humans (21-23). We report here the expression of mRNA for each active MT-1 isoform in HPT cells as a function of exposure to Cd2+, Zn2+, Cu2+, Ag2+, Hg2+, and Pb2+ at both lethal and sublethal concentrations.
Cell culture, metal treatments, and viability determinations. Total RNA samples for the analysis of MT-1 isoforms expression were obtained from a previous study that examined the viability and MT protein accumulation of HPT cells when exposed to sublethal and lethal concentrations of Cd2+, Zn2+, Cu2+, Ag2+, Hg2+, and Pb2+ (24). Stock cultures of HPT cells were grown in 75-cm2 T-flasks with a serum-free growth medium and a collagen matrix using procedures recently detailed (25). For use in experimental protocols, the cells were subcultured at a 1:2 ratio, allowed to reach confluence (6 days following subculture), and then exposed to media containing the various concentrations of metals. Thereafter, the cells were fed every 3 days with media containing the various concentrations of metals. We chose metal concentrations so that over a 16-day time course there would be situations where a loss of cell viability occurred and situations where exposure elicited no loss of cell viability. Metal concentrations eliciting these various levels of toxicity were determined in preliminary experiments. The effect of the individual components of the serum-free medium on the level of metal needed to elicit HPT cell toxicity has not been determined. These concentrations were determined to be 9, 27, and 45 µM for Cd2+; 20, 40, and 60 µM for Hg2+; 50, 100, and 150 µM for Ag2+; 50, 100, and 200 µM for Pb2+; 100, 200, and 300 µM for Zn2+; and 250, 500, and 750 µM for Cu2+ (24). Total RNA samples were obtained after 1, 4, 7, 10, 13, and 16 days of metal exposure and were used for the analysis of MT-1 isoform specific mRNA expression. Three isolates of HPT cells were used to control for possible variations in metal susceptibility. These isolates were derived from normal cortical tissue obtained from kidneys removed for renal cell carcinoma. All cultures displayed senescence by subculture 25. We used HPT cells between passages 5 and 8. Subcultured HPT cells have been shown to retain original light and ultrastructural morphology, active transport capability as assessed by dome formation and electrical properties, and the stimulation of cAMP by angiotensin but not by vasopressin (26).
RNA isolation and RT-PCR. Total RNA was isolated according to the protocol supplied with TRI REAGENT (Molecular Research Center, Inc., Cincinnati, OH) as described previously (24,27). The concentration and purity of the RNA samples were determined using spectrophotometer scan in the UV region and ethidium bromide (EtBr) visualization of intact 18S and 28S RNA bands following agarose gel electrophoresis. Total RNA (0.5 µg) was analyzed by reverse transcriptase-polymerase chain reaction (RT-PCR) as described previously (24,27). The primers developed for analysis of each of the active MT genes have been previously described (27). The primers for mRNA analysis were upper 5´CTCGAAATGGACCCCAACT3´ and lower 5´5´ATATCTTCGAGCAGGGCTGTC3´ yielding a 219-bp product for MT-1A; upper 5´GCTTGTCTTGGCTCCACA3´ and lower 5´AGCAAACCGGTCAGGTAGTTA3´ yielding a 287-bp product for MT-1B; upper 5´GCTTGTTCGTCTCACTGGTG3´and lower 5´CAGGTTGTGCAGGTTGTTCTA3´ yielding a 284-bp product for MT-1E; upper 5´AGTCTCTCCTCGGCTTGC3´ and lower 5´ACATCTGGGAGAAAGGTTGTC3´ yielding a 232-bp product for MT-1F; upper 5´CTTCTCGCTTGGGAACTCTA3´ and lower 5´AGGGGTCAAGATTGTAGCAAA3´ yielding a 309-bp product for MT-1G; upper 5´CCTCTTCTCTTCTCGCTTGG3´ and lower 5´GCAAATGAGTCGGAGTTGTAG3´ yielding a 315-bp product for MT-1H; and upper 5´TCTCCTTGCCTCGAAATGGAC3´ and lower 5´GGGCACACTTGGCACAGC3´ yielding a 151-bp product for MT-1X. Primers for glyceraldehyde 3-phosphate dehydrogenase (G3PDH) mRNA were obtained commercially (Clontech, Palo Alto, CA). The thermocycler was programmed to cycle at 95oC for a 2-min initial step, then 95oC for 15 sec and 68oC for 30 sec, with a final elongation step at 68oC for 7 min. Controls for each reaction included a no-template control where water was added instead of the RNA and a no-reverse transcriptase control where water was added instead of the enzyme. Samples were removed at 30, 35, and 40 PCR cycles to ensure that the reaction remained in the linear region. The final PCR products were electrophoresed on 2% agarose gels containing EtBr along with DNA markers.
MT-1A. The initial experimental goal was to define the basal level of MT-1A mRNA expression in HPT cells not exposed to metals. We used mRNA expression for the housekeeping gene G3PDH as a comparison for MT-1A mRNA expression. The reactions were stopped and samples removed for analysis at 30, 35, and 40 PCR cycles. The results demonstrated that basal expression of MT-1A mRNA was very low in HPT cells, demonstrating only a faint band or no band for the reaction product following 40 PCR cycles for the 3 HPT cell isolates (Fig. 1A,C). This is in contrast to G3PDH, where the same total RNA input demonstrated a convincing reaction product corresponding to G3PDH mRNA at 30 PCR cycles (Fig. 1B,C). These findings indicate that HPT cells have a low basal expression of MT-1A mRNA.
Figure 1. Expression of MT-1A and glyceraldehyde 3-phosphate dehydrogenase (G3PDH) mRNA in three HPT cell isolates. Reverse transcriptase-polymerase chain reaction (RT-PCR) products were electrophoresed on 2% agarose gels containing 0.5 µg/ml ethidium bromide. (A) Full gel showing reaction products for MT-1A from one cell isolate sampled at 30, 35, and 40 PCR cycles. (B) Full gel showing reaction products for G3PDH from the same isolate sampled at 30, 35, and 40 PCR cycles. (C) Expression of MT-1A (cycle 40) and G3PDH (cycle 30) for three cell isolates.
The effect of Cd2+ on the expression of MT-1A mRNA was also determined on the three independent HPT cell isolates after 1, 4, 7, 10, 13, and 16 days of exposure. Three concentrations of Cd2+ (9, 27, and 45 µM) were used in the time course so that the cells experienced both lethal and sublethal levels of Cd2+ exposure (24). Expression of MT-1A was increased in HPT cells as a result of Cd2+ exposure, and this increase was most pronounced at Cd2+ concentrations eliciting a loss of HPT cell viability (Fig. 2). For isolate 1, exposure to 9 µM Cd2+ elicited no loss of cell viability over 16 days of exposure, and MT-1A mRNA levels (at 40 reaction cycles) exceeded control levels, appearing to increase early in the time course and then decrease (Fig. 2A, upper panel). After exposure to either 27 or 45 µM Cd2+, where a loss of cell viability occurs late and early, respectively, in the time course, MT-1A mRNA levels were clearly increased over control values. This is effectively illustrated at 35 reaction cycles, where convincing product bands corresponding to MT-1A mRNA are present for Cd2+-treated cells, but totally absent in control cells (Fig. 2A, lower panel). The second cell isolate was more susceptible to Cd2+ and demonstrated a loss of cell viability after 1 day of exposure to 27 µM Cd2+. At the lower concentration of Cd2+ (9 µM), where cell loss was minimal during the time course, MT-1A mRNA levels were clearly elevated over control values (Fig. 2B). As was the case for the first isolate, at the lowest concentration of Cd2+ MT-1A mRNA levels appeared to increase early in the time course and return to undetectable levels by day 16 of exposure. The third cell isolate had a pattern of susceptibility to Cd2+ comparable to the first isolate and showed increased MT-1A mRNA levels and a similar pattern of MT-1A mRNA expression (Fig. 2C). These findings demonstrate that exposure to Cd2+ results in a repeatable increase in the level of MT-1A mRNA for three independent HPT cell isolates and that this increase is most pronounced at Cd2+ concentrations that impact cell viability.
|
|
Figure 2. Expression of MT-1A mRNA in human proximal tubule cells exposed to cadmium. Reverse transcriptase-polymerase chain reaction for MT-1A was performed as described using RNA isolated on days 1, 4, 7, 10, 13, and 16 of Cd exposure. Reaction products sampled at 40 cycles are shown for the control and 9 µM concentration for isolate 1 (A) and for controls and three concentrations of Cd for isolates 2 (C) and 3 (D). Samples representing higher levels of exposure for isolate 1 were removed at 35 cycles (B). In all three isolates the expression of glyceraldehyde 3-phosphate dehydrogenase was constant (data not shown). |
A single HPT cell isolate was used to determine if MT-1A mRNA accumulation is increased after exposure to lethal and sublethal concentrations of Zn2+, Cu2+, Hg2+, Ag2+, and Pb2+. HPT cells exposed to Zn2+ demonstrated an increased accumulation of MT-1A mRNA at all three concentrations compared to control (Fig. 3A). The increase in MT-1A mRNA correlated to the level of Zn2+ exposure and was most pronounced at the highest concentration, where a loss of cell viability occurred. Analysis of MT-1A mRNA accumulation in Cu2+-exposed HPT cells demonstrated increased accumulation of MT-1A mRNA similar to cells exposed to either Zn2+ or Cd2+ (Fig. 3B). In contrast to the increased accumulation of MT-1A mRNA demonstrated for HPT cells exposed to Cd2+, Zn2+, and Cu2+, there was no increase in the accumulation of MT-1A mRNA for HPT cells exposed to Hg2+, Ag2+, or Pb2+ (Fig. 3C-E). The lack of MT-1A accumulation was noted at the highest concentrations of Hg2+, Ag2+, and Pb2+ that were previously determined to elicit a loss of HPT cell viability (24). For the six metals assessed, these findings demonstrate that only exposure to Cd2+, Zn2+, or Cu2+ results in increased HPT cell accumulation of MT-1A mRNA.
|
|
Figure 3. Expression of MT-1A mRNA in isolate 1 exposed to Zn, Cu, Hg, Ag, and Pb. Reverse transcriptase-polymerase chain reaction for MT-1A was performed as described on RNA obtained on days 1, 4, 7, 10, 13, and 16 of metal exposure. Isolate 1 was exposed to the following metals at the indicated concentrations: (A) Zn, (B) Cu, (C) Hg, (D) Ag, and (E) Pb. Reaction products were removed at 40 cycles for all metals except for Zn, which was removed at 30 cycles. The expression of glyceraldehyde 3-phosphate dehydrogenase was constant (data not shown). |
MT-1E. The basal expression level of MT-1E mRNA was evaluated in three HPT cell isolates using the total RNA samples described above. Results demonstrated that basal expression of MT-1E mRNA was evident after 30 PCR cycles for each HPT cell isolate. Product intensities were comparable to those noted for the G3PDH housekeeping gene at an identical cycle number (Fig. 4). Although a qualitative observation, the relative intensities of the MT-1E mRNA reaction products varied among the cell isolates, with isolate 1 demonstrating a more intense reaction product at 30 reaction cycles. This is interesting because isolate 1 has been shown to be the most resistant to the lethal effects of Cd2+ exposure, followed by isolates 3 and 2 (24).
Figure 4. Expression of MT-1E and glyceraldehyde 3-phosphate dehydrogenase (G3PDH) mRNA in three HPT cell isolates. Reverse transcriptase-polymerase chain reaction for MT-1E and G3PDH mRNA was performed as described on RNA obtained on days 1, 4, 7, 10, 13, and 16 of cell culture. Reaction products were removed at 30 cycles.
The effect of Cd 2+ on the expression of MT-1E mRNA was also determined for the HPT cell isolates. Results showed increased expression of MT-1E for all three HPT cell isolates as a result of Cd 2+ exposure (Fig. 5), as evidenced by the notable increase in MT-1E mRNA at the lowest levels of Cd 2+ exposure that produced no loss of cell viability. The Cd 2+-induced increase in MT-1E was not concentration dependent. A single HPT cell isolate was used to demonstrate that exposure to both Zn 2+ and Cu 2+ elicited an increase in MT-1E mRNA (Fig. 6A,B). As was the case for MT-1E mRNA of Cd 2+-exposed cells, the increase in expression compared to control was evident at the lowest levels of Zn 2+ and Cu 2+ exposure where there was no loss of HPT cell viability. There were only slight increases in MT-1E mRNA accumulation as dosage levels of Zn 2+ and Cu 2+ were increased. The level of MT-1E mRNA was not increased over control when cells were exposed to Hg 2+, Ag 2+, or Pb 2+ at both lethal and sublethal concentrations (Fig. 6C-E). In fact, there appears to be a trend for a small decrease in MT-1E mRNA for cells exposed to Hg 2+, Ag 2+, and Pb 2+. These findings indicate that MT-1E mRNA is a common transcript in HPT cells and that accumulation is induced by both lethal and nonlethal exposure to Cd 2+, Zn 2+, and Cu 2+, but not by exposure to Hg 2+, Ag 2+, or Pb 2+.
|
|
Figure 5. Expression of MT-1E mRNA in human proximal tubule (HPT) cells exposed to Cd. Reverse transcriptase-polymerase chain reaction for MT-1E was performed as described on RNA from three HPT cell isolates (A,B,C) obtained on days 1, 4, 7, 10, 13, and 16 of Cd exposure. Reaction products were removed at 30 cycles for the control and three levels of Cd exposure. Glyceraldehyde 3-phosphate dehydrogenase expression was constant (data not shown). |
|
|
Figure 6. Expression of MT-1E mRNA in human proximal tubule cells exposed to Zn, Cu, Hg, Ag, and Pb. Reverse transcriptase-polymerase chain reaction for MT-1E was performed as described on RNA obtained on days 1, 4, 7, 10, 13, and 16 of metal exposure. Isolate 1 was exposed to the following metals at the indicated concentrations: (A) Zn, (B) Cu, (C) Hg, (D) Ag, and (E) Pb. Reactions products were removed at 30 cycles for all metals. The expression of glyceraldehyde 3-phosphate dehydrogenase was constant (data not shown). |
MT-1F. The basal level of MT-1F mRNA expression was also assessed in three three HPT cell isolates. MT-1F mRNA, like MT-1A mRNA, was shown to be a rare transcript in HPT cells, having only minimal basal expression in two of the three cell isolates at 40 reaction cycles (Fig. 7). This is in contrast to G3PDH, where the same total RNA input demonstrated a convincing reaction product corresponding to G3PDH mRNA at 30 PCR cycles. In contrast to the results for MT-1A and 1E mRNA expression, exposure to Cd2+, Zn2+, and Cu2+ at both lethal and sublethal concentrations did not produce any repeatable or consistent increase in the accumulation of MT-1F mRNA (Figs. 8 and 9). There was also no increase in the level of MT-1F mRNA when HPT cells were exposed to Hg2+, Ag2+, or Pb2+ (Fig. 9C-E). These results indicate that MT-1F mRNA is a rare transcript in HPT cells under basal conditions and that the level of expression is not increased due to metal exposure.
Figure 7. Expression of MT-1F mRNA in three human proximal tubule cell isolates. Reverse transcriptase-polymerase chain reaction for MT-1F and glyceraldehyde 3-phosphate dehydrogenase (G3PDH) mRNA was performed as described on RNA obtained on days 1, 4, 7, 10, 13, and 16 of cell culture. Reaction products were removed at 30 cycles for G3PDH and 40 cycles for MT-1F.
|
|
Figure 8. Expression of MT-1F mRNA in human proximal tubule (HPT) cells exposed to Cd. Reverse transcriptase-polymerase chain reaction for MT-1F was performed as described on RNA from three HPT cell isolates (A,B,C) obtained on days 1, 4, 7, 10, 13, and 16 of Cd exposure. Reaction products were removed at 40 cycles for the control and three levels of Cd exposure. In all three isolates the expression of glyceraldehyde 3-phosphate dehydrogenase was constant (data not shown). |
|
|
Figure 9. Expression of MT-1F mRNA in human proximal tubule cells exposed to Zn, Cu, Hg, Ag, and Pb. Reverse transcriptase-polymerase chain reaction for MT-1F was performed on RNA obtained following 1, 4, 7, 10, 13, and 16 days of metal exposure. Isolate 1 was exposed to the following metals at the indicated concentrations: (A) Zn, (B) Cu, (C) Hg, (D) Ag, and (E) Pb. Reaction products were removed at 40 cycles for all metals. The expression of glyceraldehyde 3-phosphate dehydrogenase was constant (data not shown). |
MT-1X. Basal expression of MT-1X mRNA was prominent and similar to expression for G3PDH for each HPT cell isolate (Fig. 10). The effect of Cd2+ on MT-1X mRNA expression was also determined on three HPT cell isolates, and the results revealed only a marginal increase in MT-1X mRNA as a result of Cd2+ exposure (Fig. 11). This finding was reinforced by the levels of MT-1X mRNA in HPT cells exposed to both Zn2+ and Cu2+, where results suggested a slight elevation in MT-1X mRNA level following metal treatment (Fig. 12A,B). However, in no instance was the increase of the magnitude found for MT-1A and MT-1E mRNA under identical conditions. There was no increase in the level of MT-1X mRNA when HPT cells were exposed to Hg2+, Ag2+, or Pb2+ (Fig. 12C-E). These results demonstrate that MT-1X mRNA is a common transcript in HPT cells and that the level of expression is not greatly influenced by metal exposure.
Figure 10. Expression of MT-1X mRNA in three human proximal tubule cell isolates. Reverse transcriptase-polymerase chain reaction for MT-1X and glyceraldehyde 3-phosphate dehydrogenase (G3PDH) mRNA was performed using RNA obtained on days 1, 4, 7, 10, 13, and 16 of cell culture. Reactions were sampled at 30 cycles for G3PDH and 30 cycles for MT-1X.
|
|
Figure 11. Expression of MT-1X mRNA in human proximal tubule (HPT) cells exposed to Cd. Reverse transcriptase-polymerase chain reaction for MT-1X was performed using RNA from three HPT cell isolates (A,B,C) obtained on days 1, 4, 7, 10, 13, and 16 of Cd exposure. Reaction products were removed at 30 cycles for the control and three levels of Cd exposure. The expression of glyceraldehyde 3-phosphate dehydrogenase was constant (data not shown). |
|
|
Figure 12. Expression of MT-1X mRNA in human proximal tubule cells exposed to Zn, Cu, Hg, Ag, and Pb. Reverse transcriptase-polymerase chain reaction for MT-1X was performed using RNA obtained on days 1, 4, 7, 10, 13, and 16 of metal exposure. Isolate 1 was exposed to the following metals at the indicated concentrations: (A) Zn, (B) Cu, (C) Hg, (D) Ag, and (E) Pb. Reaction products were removed at 30 cycles for all metals. The expression of glyceraldehyde 3-phosphate dehydrogenase was constant (data not shown). |
MT-1B, MT-1G, and MT-1H. Basal expression and metal-induced expression of mRNA for the MT-1B, MT-1G, and MT-1H genes were also determined using the above RNA samples. No expression of MT-1B mRNA was demonstrated under basal conditions or after treatment with any of the six metals (data not shown). MT-1G and MT-1H mRNA displayed marginal bands approximately 20% of the time at 40 reaction cycles; however, the occurrence of bands had no discernible pattern under basal conditions or when the cells were exposed to the six metals (data not shown). We conclude that the expression of MT-1B, MT-1G, and MT-1H mRNAs is at the limit of detection of the RT-PCR assay and that repeatable data regarding expression cannot be obtained.
One goal of this study was to determine if HPT cell cultures retained features of MT gene expression known to be present in the proximal tubule of the human kidney. Several studies using immunohistochemical analysis have shown that MT protein in the human kidney is localized exclusively in the proximal tubule (27-29). An analysis of MT mRNA expression in fetal and adult human kidney demonstrated the expression of mRNA representing the MT-2A, MT-1A, MT-1E, MT-1F, MT-1X, and MT-3 genes (27,30). For HPT cells, the present study demonstrated basal expression of MT mRNA for the MT-1A, MT-1E, MT-1F, and MT-1X genes. Earlier studies using HPT cells also demonstrated basal expression of MT protein and mRNA for the MT-2A and MT-3 gene (24,30). Basal levels of MT mRNA expression appear to be similar between the human kidney and cultured HPT cells. In total RNA preparation from human kidney tissue, mRNAs for the MT-2A, MT-1X, MT-1E, and MT-1F genes were demonstrated to be common transcripts, having expression levels close to the G3PDH housekeeping gene, while mRNAs for the MT-1A and MT-3 genes were demonstrated to be far less abundant (27,30). In the present study, basal expression of MT-1X and MT-1E mRNA was similar to expression of G3PDH mRNA in HPT cells, whereas MT-1A and MT-1F were less common transcripts. Earlier studies have shown MT-2A to be a common basal transcript and MT-3 a rarer transcript in HPT cells (24,30). Comparison of the findings between the HPT cells and the human kidney demonstrates that HPT cells retain the expected patterns of MT mRNA expression.
In a previous study, exposure of HPT cells to Cd2+, Zn2+, or Cu2+ induced a rapid and sustained accumulation of MT protein over a 16-day time course (24). In this respect, HPT cells demonstrated an expected response to Cd2+ exposure according to the large database of animal model studies (1-3,19). However, it was also shown in the previous study that the increase in MT protein elicited by HPT cell exposure to Cd2+ was not accompanied by a corresponding increase in the amount of MT-2 mRNA; even though such an increase would be expected from previous studies in animal models. Prompted by these results, an additional goal of the present study was to determine if regulation of the MT-1 genes in HPT cells exposed to metals corresponds to results from animal studies. In the mouse it has been shown that the MT-1 and MT-2 genes are coordinately regulated and that mRNA is induced by treatment with the heavy metal Cd2+ (1-3,6). In contrast to the increase in MT-1 mRNA predicted from mouse studies, the mRNA expression pattern of HPT cells exposed to Cd2+ was MT-1 isoform specific. HPT cells demonstrated no basal or Cd2+-induced expression of mRNA for the MT-1B, MT-1G, and MT-1H genes. HPT cells displayed notable basal levels of both MT-1E and MT-1X mRNA; however, only MT-1E mRNA was increased by exposure to Cd2+. HPT cells displayed low basal levels of mRNA for both the MT-1A and MT-1F genes, although only MT-1A mRNA was increased by exposure to Cd2+. These results, in conjunction with those for MT-2 described previously (24), provide convincing evidence that new features of MT gene regulation have been acquired in the human proximal tubule due to the gene duplication event in humans.
The most obvious consequence of the increased complexity and change in regulation of the human MT-1 and MT-2 genes would be to provide greater redundancy in the functional MT genes. The importance of redundancy in the MT genes can be inferred from the rodent species, in which the MT-1 and MT-2 genes are coordinately regulated and, from all examinations to date, the resulting proteins appear to be functionally equivalent. Such duplicate genes would not be expected to remain active if both were not needed for enhanced survival of the cell. Using HPT cells exposed to Cd2+ as a model, the gene duplication event in the human would further increase the level of redundancy in the absolute number of the MT genes and also in the regulation of these genes. In HPT cells, the MT-2 and MT-1X genes were demonstrated to have basal mRNA expression levels similar to G3PDH and to be unaffected by Cd2+ treatment. The MT-1E gene was also demonstrated to have a similar level of basal mRNA expression, but expression increased after exposure to Cd2+. Messenger RNA for the MT-1A gene was shown to be a minor transcript in the HPT cells under basal conditions, but increased significantly as a result of Cd2+ treatment that approached levels causing a loss of cell viability. Based on data obtained using HPT cells, the duplication event in human MT genes can be interpreted as providing a separation in the regulatory responsibility of the MT genes. That is, one subset of the human MT gene family (MT-1X and MT-2A) is responsible for providing basal levels of MT mRNA expression to the cell, and another subset (MT-1E and MT-1A) is responsible for providing an increase in MT mRNA expression due to Cd2+ exposure.
Further elucidation of the significance of an increased number of MT genes in humans is limited by the fact that no methods currently exist to determine the expression levels of individual MT-1 and MT-2 isoform-specific proteins. Without this ability, it is not possible to determine the relative contributions of decreased MT protein degradation and increased transcription rates on the induction of MT protein by metals. The antibodies currently available are believed to interact with all MT-1 and MT-2 isoforms, but this has never been convincingly shown, as the individual purified MT proteins are not available for cross-reactivity profiles. Recent development of the MT-1 and MT-2 null mouse allows the isolation of cell lines containing no basal MT protein levels. These should be excellent recipients for transfection by expression vectors containing each human MT isoform-specific gene, allowing the generation of homogeneous MT-isoform specific mRNA and proteins. The availability of such standards would allow the development and testing of assays capable of determining the level and functional properties of each specific MT isoform protein.
|
|
 |
| [References Listed in PubMed]
References and Notes
1. Hamer DH. Metallothionein. Annu Rev Biochem 55:913-951 (1986).
2. Kägi JHR. Evolution, structure and chemical activity of class I metallothioneins: an overview. In: Metallothionein III. Biological Roles and Medical Implications (Suzuki KT, Imura N, Kimura M, eds). Berlin:Birkhauser Verlag, 1993;29-56.
3. Kägi JHR, Kojima Y. Chemistry and biochemistry of metallothionein. Exper Suppl 52:25-80 (1987).
4. Palmiter RD, Findley SD, Whitmore TE, Durnam DM. MT-III, a brain-specific member of the metallothionein gene family. Proc Natl Acad Sci 89:6333-6337 (1992).
5. Quaife CJ, Findley SD, Erickson JC, Froelick GJ, Kelly EJ, Zambrowicz BP, Palmiter RD. Induction of a new metallothionein isoform (MT-IV) occurs during differentiation of stratified squamous epithelia. Biochemistry 33:7250-7259 (1994).
6. Searle PF, Davison BL, Stuart GW, Wilkie TM, Norstedt G, Palmiter RD. Regulation linkage and sequence of mouse metallothionein I and II genes. Mol Cell Biol 4:1221-1230 (1984).
7. West AK, Stallings R, Hildebrand CE, Chiu R, Karin M, Richards R. Human metallothionein genes: structure of the functional locus at 16q13. Genomics 8:513-518 (1990).
8. Stennard FA, Holloway AF, Hamilton J, West AK. Characterization of six additional human metallothionein genes. Biochim Biophys Acta 1218:357-365 (1994).
9. Richards RI, Heguy A, Karin M. Structural and functional analysis of the human metallothionein-IA gene: differential induction by metal ions and glucocorticoids. Cell 37:263-272 (1984).
10. Heguy A, West A, Richards RI, Karin M. Structure and tissue-specific expression of the human metallothionein IB gene. Mol Cell Biol 6:2149-2157 (1986).
11. Varshney U, Jarhoudi N, Foster R, Gedamu L. Structure, organization and regulation of human metallothionein IF gene: differential and cell-type-specific expression in response to heavy metals and glucocorticoids. Mol Cell Biol 6:26-37 (1986).
12. Schmidt CJ, Jubier MF, Hamer DH. Structure and expression of two human metallothionein-I isoform genes and a related pseudogene. J Biol Chem 260:7731-7737 (1985).
13. Jahroudi N, Foster R, Price-Haughey J, Beitel G, Gedamu L. Cell-type specific and differential regulation of the human metallothionein genes. J Biol Chem 265:6506-6511 (1990).
14. Cavigelli M, Kagi JHR, Hunziker PE. Cell and inducer-specific accretion of human isometallothioneins. Biochem J 292:551-554 (1993).
15. Pauwels M, Van Weyenbergh J, Soumillion A, Proost P, DeLey M. Induction by zinc of specific metallothionein isoforms in human monocytes. Eur J Biochem 220:105-110 (1994).
16. Soumillion A, Van Damme J, DeLey M. Cloning and specific polymerized-chain-reaction amplification of a third charge-separable human metallothionein isoform. Eur J Biochem 209:999-1004 (1992).
17. Schmidt CJ, Hamer DH. Cell specificity and an effect of ras on human metallothionein gene expression. Proc Natl Acad Sci USA 83:3346-3350 (1986).
18. Cousins RJ. Metallothionein--aspects related to copper and zinc metabolism. J Inherit Metab Dis 6(suppl 1):15-21 (1983).
19. Kagi JHR, Hunziker P. Mammalian metallothionein. Biol Trace Element Res 21:111-118 (1989).
20. Goering PL, Klaassen CD. Altered subcellular distribution of cadmium following cadmium pretreatment: possible mechanism of tolerance to cadmium-induced lethality. Toxicol Appl Pharmacol 70:195-203 (1983).
21. Bernard A, Roels H, Hubermont G, Buchet JP, Masson PL, Lauwerys R. Characterization of the proteinuria in Cd exposed workers. Int Arch Occup Environ Health 38:19-30 (1976).
22. Gonich HC, Indraprasit S, Rosen VJ, Neustein H, Van de Velde R, Raghavan SRV. Effect of cadmium on renal tubular function, the ATP-Na-ATPase transport system and renal tubular ultrastructure. Miner Electrolyte Metab 3:21-35 (1980).
23. Bosco E, Porta N, Diezi J. Renal handling of cadmium: a study by tubular microinjections. Arch Toxicol 7:371-373 (1986).
24. Garrett SH, Somji S, Todd JH, Sens DA. Exposure of human proximal tubule cells to Cd2+, Zn2+, and Cu2+ induces metallothionein protein accumulation but not metallothionein isoform 2 mRNA. Environ Health Perspect 106:587-595 (1998).
25. Todd JH, McMartin K, Sens DA. Enzymatic isolation and serum-free culture of human renal cells retaining properties of proximal tubule cells. In: Methods in Molecular Medicine. Human Cell Culture Protocols (Jones GE, ed). Totawa, NJ:Humana Press Inc., 1996;431-436.
26. Sens DA, Detrisac CJ, Sens MA, Rossi MR, Wenger SL, Todd JH. Tissue culture of human renal epithelial cells using a defined serum-free growth formulation. Exper Nephrol (in press).
27. Mididoddi S, McGuirt JP, Sens MA, Todd JH, Sens DA. Isoform-specific expression of metallothionein mRNA in the developing and adult human kidney. Toxicol Lett 685:17-27 (1996).
28. Nartey NO, Banerjee D, Cherian MG. Immuno-
histochemical localization of metallothionein in cell nucleus and cytoplasm of fetal human liver and kidney and its changes during development. Pathology 19:233-238 (1987).
29. Kojima Y, Hamashima Y. Immunohistochemical studies of metallothionein. II. Its detection in the human fetal kidney. Acta Histochem Cytochem 13:277-286 (1980).
30. Hoey JG, Garrett SH, Sens MA, Todd JH, Sens DA. Expression of MT-3 mRNA in human kidney, proximal tubule cell cultures, and renal cell carcinoma. Toxicol Lett 92:149-160 (1997).
Last Update: November 17, 1998 |
|
 |
|
| |